A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology demonstrateA silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our precedent news report, G6PD 1311/93 was place as the common G6PD variant in ane of the Malaysian pristine groups. Here, we report the screening for this variant via PCR-RFLP method and then(prenominal) direct sequencing of the entire 3UTR of the G6PD broker in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three unused SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3UTR. SNP ss218178024, which is turn up inside an AG-rich component, has shown a significant association with G6PD 1311/93 as it was spy solely in individuals with G6PD 1311/93. Computat ional analyses indicated that three miribonucleic acids concord potential to bind to the divisions encompassing ss218178024. Whilst transitions of A to G dose not terminate these miribonucleic acid cross grades, it extensively alters the informational RNA substitute(prenominal) structure and hits a putative hsa-miR-877* stuffing site. Notably, ss218178027 and ss218178028 do not change template RNA subaltern structure. It could be speculated that ss218178024 have a potential functional stamp on the down-regulation of template RNA and consequently G6PD wishing either by alter mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3UTR of G6PD mRNA.Genetic variations in the G6PD gene ar responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants atomic number 18 single missense mutations, with the rest cosmos either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein installment of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This geno graphic symbol has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991 2000 Jiang et al. 2006 Daoud et al. 2008 Jalloh et al. 2008 Wang et al. 2008 Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein while of the G6PD enzyme. From previous studies, association of these two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004 Wang et al 2008 Jiang et al 2006). It is illustrious that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that new(prenominal) change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency.Importance of 3UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3UTR of a moment of genes (ref). In the other word, genetic variations in the 3UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3UTR of human genes are key players in controlling of mRNA stableness, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene vista by binding to the 3UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of pubic louse have been documented (Sethupathy 2008 Shen 2008).Given that, in the present study, we sought to determine if any SNP in the 3UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing.Subjects and MethodsThis study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent.In our previous study, we attempted to identify the molecular home of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the co mmonest G6PD variant in Negrito. No other mutations were discover in the remaining exons or adjacent vicinitys of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST course of study or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of apiece exon was obtained from ENSEMBL (Transcript ENST00000393562). Then two regions of the G6PD gene (region ab and cd in hear 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manu incidenturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp).Figure 1 Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a 5 AAGACGTCCAGGATGAGGTGATC 3 and b 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 CT transition. Oligonucleotides c 5 TGGCATCAGCAAGACACTCTCTC 3 and d 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 TC. Oligonucleotides e 5 GAGCCCTGG GCACCCACCTC 3 and f 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAG CAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing.Bioinformatic ToolsWe used two computational tools for each section to confirm our results. F-SNP (http//compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http//fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3UTR of G6PD gene. The RegRNA program (http//regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http//bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3UTR was predicted using GeneBee (http//www.genebee.msu.su/genebee.html) and mFold (http//mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http//bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mR NA and miRNA.ResultsGenotypingDNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 likewise surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were to a fault heterozygote for ss218178024.Figure 2. overtone nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP.Table 2SNPIndividuals with G6PD 1311/93individuals normal for G6PD 1311/93ss218178024ss218178027ss218178028Aboriginal individual721057264Non-aboriginal individual637600Bioinformatics AnalysisSearch for reported SNPs inside of 3UTR of G6PD geneBy using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3UTR of G6PD gene including SNP ref ID rs1050831,rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.The last one is actually same with ss218178024. All of these known SNPs werediscovered via cDNA sequencing and to date no clinical associations have been reported for them. divination of putative miRNA binding sites and mRNA secon dary structureThe wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico psychoanalysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside inseminate region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA.Figure 3 The predic ted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 end of the miRNA and the 3 UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows.Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be touch by this substitution. The lower free energy in wild type indicates that mRNA world power be more stable in wild type oppose with the mutant. In the other word, it is suggesting that change mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of incomplete full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing.Consequently, secondary structure of 3UTR of G6PD mRNA has been also checked for the assentingibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G.Genotype Change in secondary structure Change in secondaryof full length of mRNA structure of 3UTR1311T No ss218178024G Yes Yes1311T+ ss218178024G Yes ss218178027A No No1311T + ss218178027A No ss218178028T No No1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3UTR (A2) compare with predicted secondary structures of full length mRNA re lating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of thefull-length mRNA and 3UTR is shown in parentheses.Statistical AnalysisDiscussionA recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Arambula et al. 2000 Nuchprayoon et al. 2008 Barisic 2005 Laosombat 2005 Pietropertosa 2001 Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the fictional characters played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To the best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3UTR for G6PD deficient individuals (Nguyen Thi Hue 2009 Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93.The roles in disease phenotypes played by sequence polymorphisms of the 3UTR have been reported (Lambert et al. 2003 Goto et al. 2001 Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefrom be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full length mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allel e A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the other view, SS contributes to fundamental interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stabl e base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA regulation of G6PD mRNA is reasonable.While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs..Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken in the first place miRNAmRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive.Here, we demonstrate that a A357G mutation may potentially change the 3UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet).However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combinatio n of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function.In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis.MicroInspector (http//www.imbb.forth.gr/microinspector) (Rusinov et al. 2005)W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issueMicroInspector a web tool for espial of miRNA binding sites in an RNA sequenceVentsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin TablerTypically, SNPs occurring in functionalgenomic regions such as protein coding or regulatoryregions are more likely to perplex functional distortion and,as such, more likely to underlie disease-causing variations.Current bioinformatics tools examine the functionaleffects of SNPs only with respect to a single biologicalfunction. Therefore, much time and effo rt is required fromresearchers to separately use multiple tools and interpretthe (often conflicting) predictions. (F-SNP Lee at al)The variant ESR1_rs2747648 affects the miRNA-binding site ofmiR-453, miR-181(b/d) and miR-219. Due to in silico analysis usingmiRanda (http//www.microrna.org/microrna/home.do), the variantESR1_rs2747648 does not significantly effect the binding capacityof miR-219 and miR-181(b/d). However, the binding capacity of miR-453 is stronger when the C variant allele is present, enabling to bindthe complemental G nucleotide of the miR-453 seed. In contrast, theT allele attenuates the binding of miR-453, which we hypothesize tolead to a reduced miRNA-mediated ESR1-repression, in consequencehigher ESR1 protein levels and an increased front cancer risk. Therefore,the breast cancer protective effect observed for the C allele isbiologically reasonable. However, functional studies are necessary totest this hypothesis. Due to the fact that endogenous estrogen levelsar e high premenopausal and drop down post-menopausal, it is plausiblethat the risk effect of this variant can only be detected inpremenopausal women.RNA secondary structure prediction was carried outusing the Vienna RNA Package 1.7.2. on the webinterface for online RNA folding on the Vienna RNAWebServers.42 The target mRNA prediction was carriedout using The microRNA.org resourceThis is likely because miRNA-mRNA bindingis mediated by the reduced instruction set computing complex, and upstream and downstreamregions of miRNA binding site may interact with RISC, whichmediates miRNA-mRNA binding (26). A polymorphism in the829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirnaSNP rs12720208 is located 166 bp downstream of the terminatingcodon of FGF20 and lies within a predicted bindingsite for microRNA (miRNA) miR-433.(A) The predicted binding site for miR-433at 30 UTR of FGF20 gene. At rs12720208,allele C base paired with G in Watson-Crickmode (as shown with a solid line), whereasallele T wobble base paired with G (as shownwith a dashed line). geenbee 2009 capassoAlthough the mechanismby which interaction of proteins with the G3A sequence mightaffect message stability remains a matter of speculation, thefact that this sequence is located within a large region of stablesecondary structure in the 39-UTR of the elastin mRNA (4)suggests the possibility that RNA/protein interactions at thissite may alter the stability of this secondary structure, perhapsaffecting the accessibility of endogenous RNases to the mRNA.However, detailed understanding of the mechanism of thisprocess awaits further characterization of the nature of bindingprotein and the consequences of its interaction with the G3Amotif in elastin mRNA.Acknowledgment-We acknowledgeGA rich HewFrom a physical point of view, we expect that theinteraction of a miRNA with its target will depend on the state of the targetregion prior to interaction. In particular, if the target sequence is already bound(by Watson-Crick base-pairing) to another section of the mRNA chain, this wille_ectively pose a barrier to the base-pairing with the miRNA, and the capacity ofsuch target sequences to mediate translational repression could be diminished. Ifwe were able to predict the accessibility of a potential miRNA binding site, thismight improve our target predictions.gi109132849AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi108773792 CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi194680256 CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG***** * ** ** * * * * * **** ** * * * ********gi109132849AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGAgi108773792 CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGAgi194680256 CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA** * * * ** ** ** * **gi109132849AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCGgi108773792 GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCAgi194680256 ATGG GCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTCIt would be anticipated that increased DHFR reduces MTXcytotoxicity in normal cells while conferring resistance in targetcells.A comparison of the human and mouse DHFR 39-UTR sequencesrevealed that only 100 nucleotides downstream from theterminator codon were conserved between the two species (18).Numerousstudies have focus on the effects of coding region variantson P-gp expression and function, whereas few noncodingregion variants have been investigated.Mechanisms that alter mRNA levels can change mRNA expressionand potentially G6PD activity. Recent evidence has demonstratedthat the 3UTR of mRNA is an important regulatory site controllinginteractions with mRNA degradation machinery (Hollams et al., 2002Tourriere et al., 2002 Mangus et al., 2003 Wilkie et al., 2003).3UTR RNA-binding proteins that recognize specific mRNA sequenceelements and secondary structure dictate the fate of mRNAtranscripts. Polymorphisms in the 3UTR of G6PD could di sruptRNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999 Hollams et al.,2002 Tourriere et al., 2002). A polymorphism in the 3UTR ofhuman tumour necrosis factor-_ changes binding affinity for a multiproteincomplex that contains the HuR regulatory protein (Di Marcoet al., 2001). HuR binds AG-rich elements in the 3UTR of certaingenes (Peng et al., 1998) and has been shown to stabilize mRNAcontaining tumor necrosis factor-_ 3_-UTR sequence motifs (Dean etal., 2001). There is one report that the 3435C_T synonymous variantdecreases mRNA stability (Wang et al., 2005), but to our knowledgeno pharmacogenetic research of this type has been conducted forABCB1 3_-UTR variants. Thus, our mRNA half-life data representnovel findings as to the effects the _89A_T, _146G_A, and_193A_G polymorphisms have on ABCB1 mRNA stability anddemonstrate the utility of using stable cell lines made with Flp-Intechnology for these measurements. Similarly