Tuesday, June 4, 2019
An introduction to the Nestle Company
An introduction to the snuggle Comp from each oneNestle was founded in 1866 by Henri Nestle with headquarters in Vevey, Switzerland. It has employed around 250,000 people and has factories or operations in al close every country in the world. It is i of the worlds grandgest food and drink Companies. The Companys priority is to bring the best and most relevant products to people, wherever they are, whatever their inevitably, throughout their lives.1.1 PURPOSE OF RESEARCHThe study of the research is to notice the variable which has leads towards departures in Nestle organic law. The main purpose of the research is, firstly, to identify the causes of battles in Nestle and, secondly, to manage participations in Nestle organization. This report willing be sustainful for students who penury to conduct a research as well as the company improving or solving the businesss.1.2 BACK GROUND OF THE STUDYAll of us experience any(prenominal) type of strifes in our occasional lives. Tensions, antagonisms, and frustrations al meanss occur when people work together. There are disagreements, perhaps even fights, in the midst of employees and the executive program or betwixt co-workers. Aside from individualality clashes, people simply have different viewpoints about the mortalal manner things should be d genius.The main purpose of conducting the research is to find out the infringes, and finding the ways to manage and solve them in an organisation. In this context we have got the opportunity to conduct our research on one of the d modernise organizations (Nestle).1.3 DEFINITION OF CONFLICTConflict is defined as the state of discord caused by perceived or actual opposition of needs, interests and values. A conflict arouse be home(a) or external. The concept of conflict empennage help to explain many social aspects of life such as social disagreement, fights between individuals, groups, or organizations and conflict of interests.Conflict as taught for gr aduate and professional work in conflict resolution which is defined as when two or to a greater extent parties, with perceived incompatible goals, seek to undermine each some others goal-seeking capability.However, conflict can similarly occur in cooperative situations, in which two or more individuals or parties have constituteent goals, because the manner in which individuals or troupe tries to reach their goal can still undermine the other individuals or party.1.4 constitution OF CONFLICTConflict may constructively be viewed as resulting from differing belief systems, varied perspectives on the situation and values resulting from participants accumulated life experience and conditioning, differing interests and objectives. in effect handleing with conflict requires the expression and focus of participants varying interests, belief systems, perspectives and values.Through the integration of participants perspectives, belief systems, interests and values, conflict and conf lict resolution play important roles in individual and social evolution and development. Conflict arises when one or more participants view the current system as not work. At least one party is adequately unhappy with the position, that they are willing to sustain the conflict and speak with the hope of being able to persuade the situation to arrive at an improved condition. Conflict may be sight as a demonstrate we put ourselves through to attain a new condition and self-importance definition.Through conflict we have opportunities to be artistically self-defining. If nothing else, conflict allows us in future to do things differently. Through the resolution of conflict, we can evolve and redefine ourselves, our community, our relationships our society and our world.1.5 LEVELS OF CONFLICT1.5.0 Inter divisional conflictInter divisional conflicts exists between the perceiver and another individual within the organization. Although the other person does not need to be aware of the conflict, the perceiver of the conflict situation recognizes the present or future impact conflict can have on job performance.1.5.1 Intra group conflictIntra group conflicts occur between perceiver and his or her immediate group within the organization. The immediate group can consist of work team, department or union. Whether fully or only tops(p)ficially aware of the conflict issue, the perceiver realizes that the conflict can directly or indirectly affect job performance.1.5.2 Inter group conflictIt arises between the perceivers immediate group and another group within the organization. Again, the perceivers takement may not be critical, barely he or she essential be aware of the situation and the potential impact the conflict can have on work performance.1.5.3 organisational conflictOrganizational conflict is a state of disagreement caused by the actual or perceived opposition of needs, values and interests between people work together.1.6 TYPES OF CONFLICTA conceptual con flict can rise into a verbal exchange or result in fighting.Conflict can exist at a variety of types. These areCommunity conflictDiplomatic conflictEmotional conflictEnvironmental resources conflictGroup conflictIdeological conflictInterpersonal conflictInter-societal conflictIntrapersonal conflictOrganizational conflictReligious-based conflict and Workplace conflict .1.7 CAUSES OF CONFLICTS1.7.0 Authority relationshipAuthority Relationship conflicts occur because of the cosmea of strong pessimistic emotions, misperceptions or stereotypes, poor communication or miscommunication, or repetitive negative behaviors. Authority relationship problems often increase disputes and lead to an need little rising spiral of destructive conflict. Supporting the secure and balanced expression of perspectives and emotions for acknowledgment (not agreement) is one effective approach to managing relational conflict.1.7.1 Management styleFor any organization to be effectual and efficient in achieving its goals, the people in the organisation need to have a common vision of what they are dogged to achieve, as well as clear objectives for each individual, group/ team and department. Management style in addition needs ways of recognizing and resolving conflict between people, so that conflict does not become so serious that collaboration becomes im workable. The focus of any organisation needs to have ways of keeping conflict to a minimum and of solving problems caused by conflict, before conflict becomes a major obstruction to work.Management style helps to vitiate conflict where probable and organizing to judge conflict where it does happen, as rapidly and beamly as possible.1.7.2 Communication barriersConflict will be greater when barriers to communication exist. If parties are separated from each other physically or by time e.g. the day shift versus the night shift-the opportunity for conflict is increased. To illustrate suppose a company employs only one plant superviso r, who works the day shift and leaves orders at the beginning of each week for the workers on the night shift. By the end of the week, how ever, these orders have been only part carried out. The supervisor cannot figure out why. Obviously, the supervisor absence from the night shift has posed a communication barrier, which in turn causes decreased output. As Bryans, P, Cronin argued in 1984 that Space or time separations could promote isolated group interests rather than advance a common effort towards joint goals.1.7.3 Personal factors1.7.3.0 BehavioralThe way emotional experience gets expressed which can be verbal or non-verbal and intentional or un-intentional.1.7.3.1 PhysiologicalIts defined as the bodily experience of emotion. The way emotions put to work us feel in comparison to our identity.1.7.3.2 Cultural valuesCulture tells people who are a part of it, Which emotions ought to be expressed in fussy situations and what emotions are to be felt.1.7.3.3 PhysicalThis escalati on results from anger or frustration.1.7.3.4 VerbalThis escalation results from negative perceptions of the annoyers character.1.8 WAYS OF ADRESSING CONFLICTSThere are basically five ways of addressing conflicts which were determine by Thomas and Kilman in 1976. These are1.8.0 AHYPERLINK http//en.wikipedia.org/wiki/AccommodationccommodationOnes party surrenders its own needs and wishes to accommodate the other party.1.8.1 AHYPERLINK http//en.wikipedia.org/wiki/Avoidance_(conflict)voidanceAvoid conflict by ignoring it, changing the subject, etc. As an expedient means of dealing with very minor, non-recurring conflicts or Avoidance can be useful as a temporary measure to buy time. In many cases, conflict avoidance involves severing a relationship.1.8.2 CHYPERLINK http//en.wikipedia.org/wiki/CollaborationollaborationWorking together can find a mutually beneficial solution. Collaboration can also be inappropriate and time-intensive. When in that respect is not enough respect, trust o r communication among participants for collaboration to occur.1.8.3 CHYPERLINK http//en.wikipedia.org/wiki/CompromiseompromiseFinding a centre point where each party is partially satisfied.1.8.4 CHYPERLINK http//en.wikipedia.org/wiki/CompetitionompetitionTake the ones point of view at the potential expense of another. It can be more useful when achieving the ones objectives outweighs ones concern for the relationshipCHAPTER 22.0 literary works REVIEWDifferent researchers have published their reviews on conflicts in the organization. We are viewing two best reviews of the researchers articles.Mr. Philips in 1982 threw light on some of aboriginal conditions, which may lead to serious organizational conflicts he gave his views in the book named as Community in Organization. According to M Phillips certain social relationships characterized mixed kinds of conflict behavior. Each one could occur in your work area. The more aware the coach-and-fours are of these conflict settings, th e better are the chances of correcting them and running a smooth operation. Mr. Philip identified communication as problem in his research. The causes of conflicts are structural factors, authority relationships, common resources, goal differences interdependence, jurisdictional ambiguities, specialization, status-inconsistencies, personal factors, communication, conflict management style, ethnical differences, emotions, perception, personalities, skills and abilities, values and ethics. According to the researcher, possible solution it is obvious that a perfect communication system is unlikely. But also perfection like rationality will not be achieved organizations do have mechanism by which they can attempt the communication system as clear as they can. Philips also suggested that thither are such devices available which can reduce the distortion and complications in communication process and suggested that communication recipients should be aware of the biases of the message send ers and protect their own counter biases as protection devices.James M Leif John M Penrose in 1997 in the book Business Strategies Skills 5th Edition explained the temper of organizational conflicts identify the causes of conflicts i.e. Structural Factors, Common Resources , Goal Differences , Interdependence , Jurisdictional Ambiguities, Inconsistencies ,Personal Factors Communication barriers, Conflict management style ,Cultural differences ,Emotions Perception, Personalities, Skills and abilities, Values and Ethics, Behavioral and Physiological Cognitive. The researchers says that it is possible to avoid conflict by having mechanism such as voting to make decision without the disagreement of consensus. They also find that behavioral regulation fail to yoke the individual need of employee, conflict is bound to occur.In 1995 B R Siwal in his research Resolution Strategies to Conflict describes that conflict is a necessary and intact part of effective problem solving and realis tic discussions. It is core sound of decision making because disagreement is the best vehicle for enlargement the perspective, discovering alternatives, and motivating original interaction among each member. The effects of disagreement, though, depend on how it is administer by team members. Conflict can be integrative and constructive or it can be distributive and disruptive. When mismanagement occur, conflict can demolish team effectiveness, when handled well it can deeply enhance the quality of team work and make members sense proud of their work in the team. Training in the temper of conflict and the ways of managing it is an imperative need of all the people who participates in problem solving groups, such as those that make up work teams. The negative association of conflicts motivations to be dispelled and substitute with more practical conceptions that made the justifiable specialisation between disruptive and constructive conflict. When team members see that conflict ca n be a positive strength in conversation, they are better prompt to take up effective proposal views and behaviors in trouble solving situations. Further more the differences between integrative and distributive conflict can help them learn how their own behavior contributes to the atmosphere of the team which they belong.Davor Dujak in 2008 describes in his research that in every organization conflict encounters on a daily basis. The conflict cannot be avoided but it is probable to mange them in a way that we identify them on time. It is essential to constantly track the organizational signals which position to their existence. If Organization does not respond accordingly, this can lead to the condition that conflict itself manages the organization. One of the more important determinants of productivity, performance and efficiency and finally the job satisfaction is also the conflict as an independent variable of organizational behavior. By systematic research of organizational b ehavior we want to make a positive influence on the dependents variables, but first we have to realize and get a good approaching to the individual elements of organizational behavior.In 2004 Melanie Lewis describes in her research that if conflict managed poorly or avoided, it can be very costly to an organization. If managed well, conflict presents an opportunity to uncover significance and promote a healthy work place. many organizations are finding that their conflicts management systems have been good by financial investments, generating a healthy return. In additional they are recognizing the value of many less substantial benefits (lower turnover, increased efficiencies, improved morale and improve public relations). A precise four phased process assessment, design, implementation, operation and evaluation helps organizations design effective conflict management systems to gather the maximum benefit of conflict system. Moreover this four phased approach powerfully encourages the team actually to seek to understand and incorporate the needs and interests of all affected constituency, and ca-cas an environment in which the benefits of the system can be effectively communicated, implemented and administered.In 2010 De Dreu C.K describes in his research that conflict is a three-d with both relationship and task forms. Hence it is expected that if they change the managing type of conflicts, it will plays an important role in organizational performance. slice if organization did not manage good, the conflict will plays a negative role. However the researcher discussed only two types of conflicts in his research namely affective and task conflict in order to play better role in organizational performance.After studying the reviews of different researchers, we will take help from different researches but our group decided that we will follow the research of M Philip because they dictate information about factors which are important for identifying conflicts and understanding the meaning of conflict and how it influences the organizations internal environment in solving problems.CHAPTER 3RESEARCH METHODOLOGY3.0 Research typeThe type of research that we are conducting is applied research because it is conducted for a particular organization. Applied research is practical applicability of research tools on a particular organizational situation.3.1 info collectionWe will be collecting our selective information by using two sources which are as follows.3.1.0 Primary entropyOur primary info is collected through conducting interviews and designed questionnaires from directors, managers and employees of Nestle.3.1.1 Secondary dataThe tributary data is collected from past records of Nestle and books along with business articles to support our recommendations and suggestions.3.2 Sample surfaceDuring this survey we have taken responses from a Sample size of 30 which is further divided into two groups. We also conducted survey from 10 manag ers and 20 employees. The sampling type that we used is non random sampling technique because we want to get information from every third employee and manager of Nestle organization. Our survey is in questionnaire and interview form, so our questionnaires consist of open end and close finish questions. We have conducted unstructured interviews, asked from the respondents to get more information.CHAPTER 4ANALYSIS4.0 INTRODUCTION TO DATA ANALYSISData analysis is a practice in which the new data is ordered and organized in order to extract useful information from it. The process of organizing and thinking about data is the key to understand what the data does and does not contain. There are varieties of ways in which people can approach data analysis, and it is infamously easy to manipulate data during the analysis phase to tote certain conclusions. There are different methods for analyzing the data for example surveys, charts, relative frequency turn offs, graphs and personal ob servations etc.4.1 ANALYSING FOR CORRECTION OF DATAWe had conducted unstructured interviews for analyzing of questionnaires which we had made for collecting data from employees and managers to check whether the answers wedded by them are right or wrong. We had found no matches the interview opposes the answers given by them in questionnaires.We have analyzed our data through frequency tables and bar charts.4.2 FREQUENCY TABLEFrequency table is one of the important concepts in mathematical statistics and a good analyzing tool. A table divided into cells by category with counts for each category in each cell. It is a kind of display of a given data, in which the frequency of each data item is found. The frequency of a data item is the number of times it occurs in the data set.4.3 BAR GRAPHA graph consisting of parallel, commonly vertical bars or rectangles with lengths proportional to the frequency with which specified quantities occur in a set of data. A bar graph is a pictographic version of statistical data in which the independent variable can attain only certain discrete values. The dependent variable may be discrete or continuous. The most common form of bar graph is the vertical bar graph, also called a column graph. This type of display allows us toCompare groups of data, andTo make generalizations about the data quickly.4.4 ANALYSIS OF QUESTIONNAIRES4.4.0 FROM MANAGEMENT1) More than the desired output of the employees make can be harmful to the organization?a) YES b) NOVariablesCodesFrequencyYes019No021 slacken 4.4.0.0 graph 4.4.0.02) There is a free flow of communication among the employeesa) YES b) NOVariablesCodesFrequencyYes0110No020Table 4.4.0.1Graph 4.4.0.13) Employees are properly informed about decision taken?a) YES b) NOVariablesCodesFrequencyYes017No023Table 4.4.0.2Graph 4.4.0.24) There is a consistency among the management policiesa) YES b) NOVariablesCodesFrequencyYes018No022Table 4.4.0.3Graph 4.4.0.35) Key post should be througha)Direct A ppointment b) PromotionVariablesCodesFrequencyDirect appointment018Promotion022Table 4.4.0.4Graph 4.4.0.44.5.1 FROM EMPLOYEES1) From how long have you been working in this organization?6 months1 year3 yearsOr more than 3 yearsVariablesCodesFrequency6 months0141 year0223 years0310Or more than 3 years044Table 4.5.1.0Graph 4.5.1.02) What kind of boss do you like to work with?FriendlyCompetentLeantDifficultVariablesCodesFrequencyFriendly0117Competent023Leant030Difficult040Table 4.5.1.1Graph 4.5.1.13) Which type of leaderships style do you like the most?AutocraticDemocraticVariablesCodesFrequencyAutocratic0118Democratic022Table 4.5.1.2Graph 4.5.1.24) How does your management is doing the evaluation among the employees?Performance baseMerit baseVariablesCodesFrequencyPerformance base0118Merit base022Table 4.5.1.3Graph 4.5.1.35) Which management level should be responsible for problems between employees? Choose any of the following peak levelMiddle levelLower levelVariablesCodesFrequencyTo p level012Middle level0217Lower level031Table 4.5.1.4Graph 4.5.1.4Q6 How do you communicate the unforeseen problem with your manager or general manager?Answer nigh of the respondents suggested that they like to meet the general managers directly for any unforeseen events.Q7 Do you think your organization should involve the employees in decision making? And why?Answer Most of employees consider that their managers are capable of taking right decisions and there is no need of involving employees. While few of them suggested that it can be a source of new and creative ideas.Q8 What can you suggest for a better management system?Answer Most of the employees have no idea about it. Few of them believe that friendly environment and better salaries can improve management system.4.6 INTER ORGANISATIONAL CONFLICTS OF NESTLEThe nature conflicts in Nestle found out through the unstructured interviews and through questionnaire with the directors the managers of NESTLE Peshawar are as followsTh e first thing which found, was the lack of training given to the employees, managers state that in the organization, employees always have to work together in groups, and if some one feels that he/she cannot work within the group, then there is some problem with that employee, but at the same time managers said that it is the organizations responsibility to teach the employees how to work together in groups through proper training. They mentioned that without training the organizations major power face serious types of irresolvable conflicts, which are definitely not fruitful to the organization.The second main reason mentioned by the manager of the company was the Selection Biases, manager said that selection biases may also lead to conflicts within the company, and these conflicts are normally personal as well. The manager said that if in cases the top management (directors) interferes in the process of hiring the employees, they might select the wrong person for the right job.On the other hand there may be serious conflicts going on between the managers the directors on the issues of authority and responsibility balance. Further if the manager takes big decisions like job confirmation salary decisions then, there may be conflicts, and these moldiness be taken by the top management (directors).The manager of NESTLE also raised the point of communications problem. They believe that every information must be communicated from their tables. If in any case any employee bypasses the manger, there may be a conflict between them. Manager also said that there is no need of any employee who bypasses the manager to access to the top management (directors). Usually the organizations do have Coordinators who are directly answerable to the top management. He said that the manager will not be able to properly deal with him and conflicts between them will arise.The manager said that young unmarried employees unremarkably indulge in office politics and make conflicts am ong the employees. According to him only married and experienced persons should be provided with the jobs.Racial problems also create conflicts among the employees. Bad attitude of the manager and arrogant nature of the boss is also one reason of conflicts.The manager said that effective person but highly cooperative person would be proffered in place of an efficient but uncooperative one.The managers presented the following ideas to prevent conflictsContractual JobsHire fire system.Authority to the managersSome of them had a fight different views. Director held the middle managements capabilities responsible for the conflicts within the organization. He also said that there is no relationship between the authority and reasonability with the conflicts. He proffered the imperative style of management in the beginning, but it should be shifted to the democratic style in the later portions.Director said that although the centralized system slows down the process of working, but it w ill also decrease the conflicts between the employees. They said that, if you (Employee) have to be successful in the company, then you have to become a big YES SIR.One of the director also mentioned that horizontal conflicts are more common. Super seeded persons normally indulge in making conflicts. He said that super seeded persons should be terminated in place of super seeding them. Dress code can experience the anger from the employees due to Ethnic affiliations to some dresses.Directors were strongly in favor of Coordinator, they said that a coordinator channels the communication process between the manager and the top management. He also gave the following ideas to prevent the possible conflicts in the organizationsPromotionsClear line of AuthorityNot more than one employee from same Regional locations and same institutions/Universities.CHAPTER 55.0 CONCLUSIONThe Organizational Conflicts is itself not a problem, but it is a serious symptom of some factors that are usually ign ored while designing the organizational structures. From the literature review, taking samples (convenience) analysis of the data gathered. Some factors are identified that usually are the root cause of the conflicts. Some of these areEthnicityPersonal JealousyArrogant behaviors (low temperament)Communication problemsDue to the nature of the issue the responses from the top (Directors), middle (Managers) lower management (Employees) were totally contrary with each other. For this purpose structured questionnaires (covering both open ended and close ended questions) and unstructured interviews were conducted. That made the deductions possible by comparing the verbal and non verbal responses, rephrasing the same questions two-three times to check the consistency of the replies.The ethnic issue is the most important. Due to ethnicity no sampled branch has been successful in implementing the dress code yet. Even though, all the respondents favoured it.It is observed that employees bel onging to KHYBER PUKHTUNKHWA are very low tempered. Their frequency of jobs switching is higher than others. It proves that they cannot work in teams and work with an arrogant manager.To conclude, who should be held responsible for conflicts, the manager is the key person who channels the communication whether upward or down ward.5.1 RECOMMENDATIONSThe current thinking should be for the maximum utilization of the companys resources and to push the power and decision making authority down the hierarchy of the organization. This can create more power and flexibility within the company as a whole.Good leaders should not have any problem in deputation power and responsibility.Disagreement with the supervisor should be encouraged as long as it leads to productive results.It is critical for the manager to get diverse work force out to work well together and respect their differences. Diversity should be encouraged because it can help the organization in future to adapt to the changing spheric market.All problems can be prevented from happening and/or rectified, if the middle management (Manager) of the company justifies its position. Middle management plays an anchor role. Manager should be able to deal with all the employees who have different cultural backgrounds, personalities priorities. Hiring experienced and matured managers and providing them training could help the case.On job training of the employees.Open house discussions should be there at least one a month.While assigning the groups to the employees for tasks, it must be assured that all the groups are properly matched.REFERENCEB R Siwal, S 1995, Conflict Resolution Strategies, last viewed date 16 dec, 2010, http//www.scribd.com/doc/19166679/Conflict-ResolutionJacob.Bervich, S 1997, Conflict and Conflict Management in Organizations, last viewed date 12 dec, 2010, .http//docs.google.com/viewer?a=vHYPERLINK http//doc
Monday, June 3, 2019
A Silent Mutation With Unknown Mechanism Biology Essay
A Silent Mutation With Unknown Mechanism Biology demonstrateA silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our precedent news report, G6PD 1311/93 was place as the common G6PD variant in ane of the Malaysian pristine groups. Here, we report the screening for this variant via PCR-RFLP method and then(prenominal) direct sequencing of the entire 3UTR of the G6PD broker in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three unused SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3UTR. SNP ss218178024, which is turn up inside an AG-rich component, has shown a significant association with G6PD 1311/93 as it was spy solely in individuals with G6PD 1311/93. Computat ional analyses indicated that three miribonucleic acids concord potential to bind to the divisions encompassing ss218178024. Whilst transitions of A to G dose not terminate these miribonucleic acid cross grades, it extensively alters the informational RNA substitute(prenominal) structure and hits a putative hsa-miR-877* stuffing site. Notably, ss218178027 and ss218178028 do not change template RNA subaltern structure. It could be speculated that ss218178024 have a potential functional stamp on the down-regulation of template RNA and consequently G6PD wishing either by alter mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3UTR of G6PD mRNA.Genetic variations in the G6PD gene ar responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants atomic number 18 single missense mutations, with the rest cosmos either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein installment of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This geno graphic symbol has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991 2000 Jiang et al. 2006 Daoud et al. 2008 Jalloh et al. 2008 Wang et al. 2008 Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein while of the G6PD enzyme. From previous studies, association of these two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004 Wang et al 2008 Jiang et al 2006). It is illustrious that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that new(prenominal) change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency.Importance of 3UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3UTR of a moment of genes (ref). In the other word, genetic variations in the 3UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3UTR of human genes are key players in controlling of mRNA stableness, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene vista by binding to the 3UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of pubic louse have been documented (Sethupathy 2008 Shen 2008).Given that, in the present study, we sought to determine if any SNP in the 3UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing.Subjects and MethodsThis study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent.In our previous study, we attempted to identify the molecular home of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the co mmonest G6PD variant in Negrito. No other mutations were discover in the remaining exons or adjacent vicinitys of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST course of study or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of apiece exon was obtained from ENSEMBL (Transcript ENST00000393562). Then two regions of the G6PD gene (region ab and cd in hear 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manu incidenturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp).Figure 1 Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a 5 AAGACGTCCAGGATGAGGTGATC 3 and b 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 CT transition. Oligonucleotides c 5 TGGCATCAGCAAGACACTCTCTC 3 and d 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 TC. Oligonucleotides e 5 GAGCCCTGG GCACCCACCTC 3 and f 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAG CAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing.Bioinformatic ToolsWe used two computational tools for each section to confirm our results. F-SNP (http//compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http//fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3UTR of G6PD gene. The RegRNA program (http//regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http//bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3UTR was predicted using GeneBee (http//www.genebee.msu.su/genebee.html) and mFold (http//mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http//bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mR NA and miRNA.ResultsGenotypingDNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 likewise surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were to a fault heterozygote for ss218178024.Figure 2. overtone nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP.Table 2SNPIndividuals with G6PD 1311/93individuals normal for G6PD 1311/93ss218178024ss218178027ss218178028Aboriginal individual721057264Non-aboriginal individual637600Bioinformatics AnalysisSearch for reported SNPs inside of 3UTR of G6PD geneBy using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3UTR of G6PD gene including SNP ref ID rs1050831,rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.The last one is actually same with ss218178024. All of these known SNPs werediscovered via cDNA sequencing and to date no clinical associations have been reported for them. divination of putative miRNA binding sites and mRNA secon dary structureThe wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico psychoanalysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside inseminate region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA.Figure 3 The predic ted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 end of the miRNA and the 3 UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows.Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be touch by this substitution. The lower free energy in wild type indicates that mRNA world power be more stable in wild type oppose with the mutant. In the other word, it is suggesting that change mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of incomplete full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing.Consequently, secondary structure of 3UTR of G6PD mRNA has been also checked for the assentingibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G.Genotype Change in secondary structure Change in secondaryof full length of mRNA structure of 3UTR1311T No ss218178024G Yes Yes1311T+ ss218178024G Yes ss218178027A No No1311T + ss218178027A No ss218178028T No No1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3UTR (A2) compare with predicted secondary structures of full length mRNA re lating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of thefull-length mRNA and 3UTR is shown in parentheses.Statistical AnalysisDiscussionA recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Arambula et al. 2000 Nuchprayoon et al. 2008 Barisic 2005 Laosombat 2005 Pietropertosa 2001 Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the fictional characters played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To the best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3UTR for G6PD deficient individuals (Nguyen Thi Hue 2009 Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93.The roles in disease phenotypes played by sequence polymorphisms of the 3UTR have been reported (Lambert et al. 2003 Goto et al. 2001 Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefrom be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full length mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allel e A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the other view, SS contributes to fundamental interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stabl e base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA regulation of G6PD mRNA is reasonable.While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs..Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken in the first place miRNAmRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive.Here, we demonstrate that a A357G mutation may potentially change the 3UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet).However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combinatio n of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function.In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis.MicroInspector (http//www.imbb.forth.gr/microinspector) (Rusinov et al. 2005)W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issueMicroInspector a web tool for espial of miRNA binding sites in an RNA sequenceVentsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin TablerTypically, SNPs occurring in functionalgenomic regions such as protein coding or regulatoryregions are more likely to perplex functional distortion and,as such, more likely to underlie disease-causing variations.Current bioinformatics tools examine the functionaleffects of SNPs only with respect to a single biologicalfunction. Therefore, much time and effo rt is required fromresearchers to separately use multiple tools and interpretthe (often conflicting) predictions. (F-SNP Lee at al)The variant ESR1_rs2747648 affects the miRNA-binding site ofmiR-453, miR-181(b/d) and miR-219. Due to in silico analysis usingmiRanda (http//www.microrna.org/microrna/home.do), the variantESR1_rs2747648 does not significantly effect the binding capacityof miR-219 and miR-181(b/d). However, the binding capacity of miR-453 is stronger when the C variant allele is present, enabling to bindthe complemental G nucleotide of the miR-453 seed. In contrast, theT allele attenuates the binding of miR-453, which we hypothesize tolead to a reduced miRNA-mediated ESR1-repression, in consequencehigher ESR1 protein levels and an increased front cancer risk. Therefore,the breast cancer protective effect observed for the C allele isbiologically reasonable. However, functional studies are necessary totest this hypothesis. Due to the fact that endogenous estrogen levelsar e high premenopausal and drop down post-menopausal, it is plausiblethat the risk effect of this variant can only be detected inpremenopausal women.RNA secondary structure prediction was carried outusing the Vienna RNA Package 1.7.2. on the webinterface for online RNA folding on the Vienna RNAWebServers.42 The target mRNA prediction was carriedout using The microRNA.org resourceThis is likely because miRNA-mRNA bindingis mediated by the reduced instruction set computing complex, and upstream and downstreamregions of miRNA binding site may interact with RISC, whichmediates miRNA-mRNA binding (26). A polymorphism in the829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirnaSNP rs12720208 is located 166 bp downstream of the terminatingcodon of FGF20 and lies within a predicted bindingsite for microRNA (miRNA) miR-433.(A) The predicted binding site for miR-433at 30 UTR of FGF20 gene. At rs12720208,allele C base paired with G in Watson-Crickmode (as shown with a solid line), whereasallele T wobble base paired with G (as shownwith a dashed line). geenbee 2009 capassoAlthough the mechanismby which interaction of proteins with the G3A sequence mightaffect message stability remains a matter of speculation, thefact that this sequence is located within a large region of stablesecondary structure in the 39-UTR of the elastin mRNA (4)suggests the possibility that RNA/protein interactions at thissite may alter the stability of this secondary structure, perhapsaffecting the accessibility of endogenous RNases to the mRNA.However, detailed understanding of the mechanism of thisprocess awaits further characterization of the nature of bindingprotein and the consequences of its interaction with the G3Amotif in elastin mRNA.Acknowledgment-We acknowledgeGA rich HewFrom a physical point of view, we expect that theinteraction of a miRNA with its target will depend on the state of the targetregion prior to interaction. In particular, if the target sequence is already bound(by Watson-Crick base-pairing) to another section of the mRNA chain, this wille_ectively pose a barrier to the base-pairing with the miRNA, and the capacity ofsuch target sequences to mediate translational repression could be diminished. Ifwe were able to predict the accessibility of a potential miRNA binding site, thismight improve our target predictions.gi109132849AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi108773792 CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGGgi194680256 CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG***** * ** ** * * * * * **** ** * * * ********gi109132849AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGAgi108773792 CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGAgi194680256 CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA** * * * ** ** ** * **gi109132849AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCGgi108773792 GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCAgi194680256 ATGG GCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTCIt would be anticipated that increased DHFR reduces MTXcytotoxicity in normal cells while conferring resistance in targetcells.A comparison of the human and mouse DHFR 39-UTR sequencesrevealed that only 100 nucleotides downstream from theterminator codon were conserved between the two species (18).Numerousstudies have focus on the effects of coding region variantson P-gp expression and function, whereas few noncodingregion variants have been investigated.Mechanisms that alter mRNA levels can change mRNA expressionand potentially G6PD activity. Recent evidence has demonstratedthat the 3UTR of mRNA is an important regulatory site controllinginteractions with mRNA degradation machinery (Hollams et al., 2002Tourriere et al., 2002 Mangus et al., 2003 Wilkie et al., 2003).3UTR RNA-binding proteins that recognize specific mRNA sequenceelements and secondary structure dictate the fate of mRNAtranscripts. Polymorphisms in the 3UTR of G6PD could di sruptRNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999 Hollams et al.,2002 Tourriere et al., 2002). A polymorphism in the 3UTR ofhuman tumour necrosis factor-_ changes binding affinity for a multiproteincomplex that contains the HuR regulatory protein (Di Marcoet al., 2001). HuR binds AG-rich elements in the 3UTR of certaingenes (Peng et al., 1998) and has been shown to stabilize mRNAcontaining tumor necrosis factor-_ 3_-UTR sequence motifs (Dean etal., 2001). There is one report that the 3435C_T synonymous variantdecreases mRNA stability (Wang et al., 2005), but to our knowledgeno pharmacogenetic research of this type has been conducted forABCB1 3_-UTR variants. Thus, our mRNA half-life data representnovel findings as to the effects the _89A_T, _146G_A, and_193A_G polymorphisms have on ABCB1 mRNA stability anddemonstrate the utility of using stable cell lines made with Flp-Intechnology for these measurements. Similarly
Sunday, June 2, 2019
The High Price of Education Essay -- Argumentative Persuasive Essays
The High Price of EducationOnce again, students at State University leave alone pay more in information during the 2005-2006 academic year, by a 4.5 percent increase. The State display panel of Regents was presented with a proposed 5.2 percent increase at its kinsfolk 23-24 meeting in Capital City, but decided this month that a 4.5 percent increase in tuition was more reasonable. Even with the additional run that could be made available by the tuition hike, the students should not have to pay this increase. According to the memorandum, the tuition proceeds at State University will go toward student financial aid, inflation, library acquisitions and services, learning communities, the four-year graduation plan, study-abroad programs, graduate assistantships and computing and information technology. The extra funds acquired from the raise in tuition are meant to make better the quality of education, however, the proposed increase impedes State Universitys commitment of affordabil ity and access for its students. As a tuition-paying freshman at State University, this raise will directly effect my already currently suffering bank account and me. I applaud the board for its efforts to improve the quality of higher education for students, and for seeking to help State University in its goal to become the best institution in the nation. Although I dont approve of a 4.5 percent tuition hike for students to increase the funding of various programs at the university, or as a means to help achieve State Universitys goal. Each time the tuition goes up, it makes it harder for aspiring college-bound students to come to school here. What kind of restore will a higher tuition have on students? If the cost of living plus tuition pushes students to w... ...this increase are not tuition-paying students, but administrators overseeing the institutions from a distance. This raise may have no effect on their bank account, or may even provide the funds for their salary increase s. If we as students dont combine with these allocations, we need to speak out and let our views be known. Our opinions will be considered, but only if we take them to someone other than our roommates, such as the Board members themselves. A few years ago, the Regents actually changed the tuition rate during the process due to student feedback, so we shouldnt assume the decision is out of our hands. It may seem as though our bills each September and January are much lower in comparison to other universities, however, we cant just sit back and accept tuition increases that come our way. After all, it is our money and financial future that is at stake.
Saturday, June 1, 2019
Christianity and The Chronicles of Narnia Essay -- Chronicles of Narni
Christianity and The Chronicles of Narnia C. S. Lewis, a well-known author and apologist, is best known by people of all ages for his seven flashiness series entitled The Chronicles of Narnia. As Lewis wrote about the land of Narnia, an imaginary world visited by children of this world, he had two obvious purposes to entertain the readers and to suggest analogies of the Christian faith. Although close to feel that his stories are violent, Lewis is successful at using fiction to open peoples hearts to accepting Christ as their Savior because he first entertains the auditory sense with a wonderful story. Lewis talked about how he came to write the books of Narnia, saying that they all began with a picture of a Faun carrying an umbrella and parcels in a snowy woods (Lewis 79). The Chronicles tell of the different adventures of English children as they visit the kingdom of Narnia and fall in love with the lion Aslan. Aslan, the son of the Emperor over Sea, can be compared to this worlds Jesus Christ (Schakel 133). As a child, Lewis always favored fairy tales and fantasies as an adult, he decided to write one (Lewis 60). And so began The Chronicles of Narnia. Rather than readying to write a fictional book that succeeded in using apologetics, Lewis admits that the element of Christianity, as with Aslan, entered of its own accord (Hooper 31). Walter Hooper, C. S. Lewis biographer, describes Lewis as being the most religious patch he ever met (Schakel 132). For this reason, no matter what Lewis wrote, his religion would greatly impact all of his works. Although Christian symbolism can be found... ...rtainer. Works Cited Dorsett, Lyle W. and Marjorie Lamp Mead, eds. C. S. Lewis Letters to Children. natural York Macmillan Publishing Company, 1985. Holbrook, David. The Skeleton in the Wardrobe C. S. Lewiss Fantasies A Phenomenological Study. Lewisburg Bucknell University Press, 1991. Hooper, Walter. Past Wa tchful Dragons The Narnian Chronicles of C. S. Lewis. New York Collier Books, 1979. Lewis, C. S. Of This and Other Worlds. Ed. Walter Hooper. St. James Place, London Collins, 1982. Martin, Holly Bigelow. C. S. Lewis in the Secular Classroom. The bulletin of the New York C. S. Lewis Society 22.4 (1991) 1-7. Schakel, Peter J. Reading with the Heart The Way Into Narnia. Grand Rapids, Michigan William B. Eerdmans Publishing Company, 1979.
Friday, May 31, 2019
A Corporate Code of Ethics is Not Enough Essay -- Sarbanes-Oxley Act o
After news of the scandal of Enron, one of the hottest items on e-Bay was a 64-page copy of Enrons corporate code of ethics. i seller/former employee proclaimed it had never been opened. In the forward Kenneth L. Lay, CEO of Enron stated, We want to be proud of Enron and to know that it enjoys a reputation for fairness and candor and that it is respected (Enron 2). For a company with such an extensive code of ethics and a CEO who seemed to want the company to be respected for that, there argon still so many unanswered questions of what exactly went wrong. I believe that simply having a solid and thorough code of ethics alone does not prevent a company from acting unethically when given the right opportunity.Investors and the media once considered Enron to be the company of the future. The company had detailed code of ethics and almighty front men like Kenneth Lay, who is the son of a Baptist minister and whose experience son was studying to enter the ministry (Flynt 1). Unf ortunately the Enron board waived the companys own ethic code requirements to allow the companys Chief Financial Officer to serve as a general partner for the partnership that Enron was victimisation as a conduit for much of its business. They also allowed discrepancies of millions of dollars. It was not until whistleblower Sherron S. Watkins stepped forward that the deceit began to unravel. Enron finally declared bankruptcy on December 2, 2001, leaving employees with disclose jobs or money. For a company to be successful ethically, it must go beyond the notion of simple legal compliance and adopt a values-based organizational shade. A corporate code of ethics can be a very valuable and integral part of a companys culture but I believe that it is not strong enough to stand alone. Thought and care must go into constructing the code of ethics and the implementation of it. Companies charter to infuse ethics and integrity throughout their corporate culture as well as into thei r definition of success. To be successfully ethical, companies must go beyond the notion of simple legal compliance and adopt a values-based organizational culture.Creating a Solid Code of EthicsWhat a Code of Ethics Should imply The importance of having a code of ethics is to define acceptable behaviors and promote higher standards of practice within a company. The code should provide a benchmark for... ...ys code but to our own code. We must make the choice of what is right and wrong and if put in a situation that is against our code we must stand up for what is right. A corporate code of ethics is a necessity in todays society, but the company cannot simply swear on just a code. For the code to be successful, the company must prove to their employees that they have the desire and drive to back the words of their code.BibliographyEnron. Code of Ethics. Jul. 2000. 20 Feb. 2005. . Flynt, Sean. Enron Whistleblower Tells Chilling Tale of Corporate Ruin. Samford University. Ed. Donna Fitch. 19 Feb. 2004. 3 Mar. 2005. .Hawkins, John. The Path to Ethical Internalization Moving the Code from the Wall to Daily Life. Leadership Lifestyle. May. 2003 Johnson & Johnson. Our Credo. 18 August 2004. 3 Mar. 2005. .Wee, Heesun. Corporate Ethics Right Makes Might. Business Week Online. Ed. Douglas Harbrecht. 11 Apr. 2002. 3 Mar. 2005. United States of America. One Hundred Seventh Congress. Sarbanes-Oxley Act of 2002. second base 406.Brooks, Leonard J. Business & Professional Ethics for Directors, Executives, & Accountants. Mason Thompson South-Western, 2004. p227.
Tuesday, September 4, 2018
'Rhetorical Analysis of I Have a Dream'
'The saving I gestate a Dream, by Martin Luther baron Jr., succeeds in illustrating the anti corrosive problems of the clock, provoking the earshot into depression consonant as head as providing forecast to the discourage Afro-the Statesn population. He builds his commands bright and persuasively by utilizing anaphora, fable and establishing ethos.\n archetypal and foremost, the phrasal idiom in a flash is the age is perennial one-third cadence in ternion successive sentences in the row. This repeat in effect delivers and reinforces the depicted object that the speech is aimed to reach out: stainless and present(prenominal) mo is needful at that time, when the lightlessness is equable not liberal, when the blackamoor is suave sadly game by the manacles of separationism and the set up of favouritism and that it is intimately observe that America has defaulted on this promissory distinguish so farthermost as her citizens of likeness are come to. much specifically, the black Ameri hatfuls is fluent toughened with tough racial detriment and suffers from low lives. Therefore, savage urging towards drastic measures is of strong disposition in order to rectify and declaration the appall situation. As a result, world powers all important(p) idea, which highlights the deliver substance of arcminute action, seeps into peoples soul and gathers cogency through and through the expressive repetition and emphasis. Additionally, this rhetorical learning overly in effect ameliorates the presentations rhythm, expression and flow.\n exponents argument is also logically furthered by his full substance abuse of fable: without delay is the time to face- scrape up from the profane and unembellished valley of separationism to the sunlit highway of racial in referee. forthwith is the time to lift our population from the quicksands of racial justice to the fast argument of brotherhood. Here, King compares contrariety as the spicy and double-dyed(a) valley and the quicksands magic spell equating is referred to the sunlit lead and the square agitate. Unpleasant, unsafe and depressing images can be deduc... '
Monday, September 3, 2018
'The Meaning of Happiness'
' bliss has close to(prenominal) opposite commentarys for many a(prenominal) an(prenominal) divergent nation, and bliss changes chthonian legitimate circumstances. For many commonwealth merriment could be having property and power, meanwhile for other someone blessedness could be macrocosm sizeable and having certain(a)(p) liaisons in their sustenance in darling position. some characters in distinguishable books dedicate various melodic themes of blessedness, or opposite things that they couldve had that wouldve organize them joyous. critical points description of laughing(prenominal) would nigh possible be a capacious distinction from the definition of enjoyment for a duet of players on the secret plan Survivor. My definition would resist from the thought processs of gratification compared to both(prenominal) hamlet and a agree of players on Survivor. gratification is a transient thing and is neer a commodious verge fancyl. ab t abu mickle filter to be quick-witted, roughly people gain their satisfaction and some strength go ? imbalanced? in the attempt for felicity or doing certain things that rotter go by to their gaiety.\n hamlet is a really innate(predicate) man. hamlet in a spirit went a second gear ? frenzied? it is moot that he never power saw his capture and that he was on the button doddering and approximated the determine entirely. If he did imagine it all, it was his conscience act to ask him opinion comfortable, indeed difficult to make him observe halcyon. I mean hamlet would throw away matt-up happy if he had a convening family give care everyone else and if his obtain had non betrayed or false a untried ripple so apace. He valued to penalize his stupefy because the idea of him remnanting peace waxy make him receive happy. If his engender would keep not for master the closing of his buzz off so quickly and not lead to sleep with other man, which was critical points uncle, by chance settlement wouldve been happier. His idea of happiness was to open a recipe family and not having to strike back his return, juncture wouldnt be happy until he ?knew his father could rest in peace. His prototype of happiness was much towards a ban side, and with this negativity came out his positivity.\nIn... If you extremity to get a full essay, baffle it on our website:
'
'
Subscribe to:
Posts (Atom)